Molecular analysis of H&E- and Papanicolau-stained samples-systematic review.

Molecular pathology allows the identification of causative agents in infectious diseases and detection of biomarkers important for prediction of disease susceptibility, diagnosis and personalized therapy. Accordingly, nucleic acid-based methods have gained a special role in clinical laboratories particularly to evaluate solid and hematological tumors. Extraction of nucleic acids is commonly performed in microdissected formalin-fixed paraffin-embedded (FFPE) or cytological samples that had been previously evaluated through the use of hematoxylin and eosin (H&E) or Papanicolau (Pap) stains, respectively.

Although the effect of both stains on nucleic acids integrity has been explored by several authors, the results are not consistent and require further examination. Accordingly, the goal of this review was to assess the influence of H&E and Pap stains on DNA and RNA integrity and to address the mechanism by which each staining compromises molecular based-analysis. The analyzed studies demonstrate that H&E- and Pap-staining result in low DNA recovery and some degree of DNA fragmentation.

Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit
DLR-FcgR3B-Hu-96T	DL Develop	96T	EUR 647
Should the Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit
DL-FcgR3B-Hu-192	DLdevelop	1 kit of 192 tests	EUR 1103
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B)

Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit
DL-FcgR3B-Hu-48	DLdevelop	1 kit of 48 tests	EUR 465
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B)

Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit
DL-FcgR3B-Hu-96	DLdevelop	1 kit of 96 tests	EUR 621
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B)

Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit
RDR-FcgR3B-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522

Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit
RDR-FcgR3B-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724

Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit
RD-FcgR3B-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit
RD-FcgR3B-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

FCGR3B Antibody
1-CSB-PA008544LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FCGR3B. Recognizes FCGR3B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

FCGR3B siRNA
20-abx916694	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FCGR3B cloning plasmid
CSB-CL008544HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 702 Sequence: ATGTGGCAGCTGCTCCTCCCAACTGCTCTGCTACTTCTAGTTTCAGCTGGCATGCGGACTGAAGATCTCCCAAAGGCTGTGGTGTTCCTGGAGCCTCAATGGTACAGCGTGCTTGAGAAGGACAGTGTGACTCTGAAGTGCCAGGGAGCCTACTCCCCTGAGGACAATTCCACACA Show more
Description: A cloning plasmid for the FCGR3B gene.

FCGR3A/FCGR3B Antibody
1-CSB-PA676166	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against FCGR3A/FCGR3B. Recognizes FCGR3A/FCGR3B from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC-p:1:50-300, ELISA:1:10000-20000

FCGR3B Polyclonal Antibody
31372-100ul	SAB	100ul	EUR 252

FCGR3B Polyclonal Antibody
31372-50ul	SAB	50ul	EUR 187

FCGR3B Polyclonal Antibody
28411-100ul	SAB	100ul	EUR 252

FCGR3B Polyclonal Antibody
28411-50ul	SAB	50ul	EUR 187

FCGR3A / FCGR3B Antibody
20-abx323190	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

FCGR3B Rabbit pAb
A13980-100ul	Abclonal	100 ul	EUR 308

FCGR3B Rabbit pAb
A13980-200ul	Abclonal	200 ul	EUR 459

FCGR3B Rabbit pAb
A13980-20ul	Abclonal	20 ul	EUR 183

FCGR3B Rabbit pAb
A13980-50ul	Abclonal	50 ul	EUR 223

FCGR3B Rabbit pAb
A7894-100ul	Abclonal	100 ul	EUR 308

FCGR3B Rabbit pAb
A7894-200ul	Abclonal	200 ul	EUR 459

FCGR3B Rabbit pAb
A7894-20ul	Abclonal	20 ul	EUR 183

FCGR3B Rabbit pAb
A7894-50ul	Abclonal	50 ul	EUR 223

Anti-FCGR3B antibody
STJ115915	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a low affinity receptor for the Fc region of gamma immunoglobulins (IgG). The encoded protein acts as a monomer and can bind either monomeric or aggregated IgG. This gene may function to capture immune complexes in the peripheral circulation. Several transcript variants encoding different isoforms have been found for this gene. A highly-similar gene encoding a related protein is also found on chromosome 1.

Anti-FCGR3B antibody
STJ110203	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a low affinity receptor for the Fc region of gamma immunoglobulins (IgG). The encoded protein acts as a monomer and can bind either monomeric or aggregated IgG. This gene may function to capture immune complexes in the peripheral circulation. Several transcript variants encoding different isoforms have been found for this gene. A highly-similar gene encoding a related protein is also found on chromosome 1.

FCGR3B Polyclonal Conjugated Antibody
C31372	SAB	100ul	EUR 397

FCGR3B Polyclonal Conjugated Antibody
C28411	SAB	100ul	EUR 397

FCGR3B Antibody, HRP conjugated
1-CSB-PA008544LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FCGR3B. Recognizes FCGR3B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FCGR3B Antibody, FITC conjugated
1-CSB-PA008544LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FCGR3B. Recognizes FCGR3B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FCGR3B Antibody, Biotin conjugated
1-CSB-PA008544LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FCGR3B. Recognizes FCGR3B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human FCGR3B shRNA Plasmid
20-abx951549	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Sheep FCGR3b ELISA Kit
ESF0073	Abclonal	96Tests	EUR 521

Rat FCGR3b ELISA Kit
ERF0073	Abclonal	96Tests	EUR 521

Rabbit FCGR3b ELISA Kit
ERTF0073	Abclonal	96Tests	EUR 521

Mouse FCGR3b ELISA Kit
EMF0073	Abclonal	96Tests	EUR 521

Monkey FCGR3b ELISA Kit
EMKF0073	Abclonal	96Tests	EUR 521

Porcine FCGR3b ELISA Kit
EPF0073	Abclonal	96Tests	EUR 521

Goat FCGR3b ELISA Kit
EGTF0073	Abclonal	96Tests	EUR 521

Anserini FCGR3b ELISA Kit
EAF0073	Abclonal	96Tests	EUR 521

Bovine FCGR3b ELISA Kit
EBF0073	Abclonal	96Tests	EUR 521

Human FCGR3B ELISA Kit
ELA-E9986h	Lifescience Market	96 Tests	EUR 824

Human FCGR3b ELISA Kit
EHF0073	Abclonal	96Tests	EUR 521

Canine FCGR3b ELISA Kit
ECF0073	Abclonal	96Tests	EUR 521

Chicken FCGR3b ELISA Kit
ECKF0073	Abclonal	96Tests	EUR 521

FCGR3B Recombinant Protein (Human)
RP039058	ABM	100 ug	Ask for price

Polyclonal FCGR3B Antibody (N-term)
APR04631G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FCGR3B (N-term). This antibody is tested and proven to work in the following applications:

Guinea Pig FCGR3b ELISA Kit
EGF0073	Abclonal	96Tests	EUR 521

FCGR3B ORF Vector (Human) (pORF)
ORF013020	ABM	1.0 ug DNA	EUR 354

FCGR3B CD16b Human Recombinant Protein
PROTO75015	BosterBio	Regular: 10ug	EUR 317
Description: FCGR3B produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 188 amino acids (21-200a.a.) and having a molecular mass of 21.4kDa. (Molecular size on SDS-PAGE will appear at approximately 28-40kDa).;FCGR3B is expressed with an 8 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.

FCGR3B sgRNA CRISPR Lentivector set (Human)
K0769801	ABM	3 x 1.0 ug	EUR 339

FCGR3B sgRNA CRISPR Lentivector (Human) (Target 1)
K0769802	ABM	1.0 ug DNA	EUR 154

FCGR3B sgRNA CRISPR Lentivector (Human) (Target 2)
K0769803	ABM	1.0 ug DNA	EUR 154

FCGR3B sgRNA CRISPR Lentivector (Human) (Target 3)
K0769804	ABM	1.0 ug DNA	EUR 154

FCGR3B Protein Vector (Human) (pPB-C-His)
PV052077	ABM	500 ng	EUR 481

FCGR3B Protein Vector (Human) (pPB-N-His)
PV052078	ABM	500 ng	EUR 481

FCGR3B Protein Vector (Human) (pPM-C-HA)
PV052079	ABM	500 ng	EUR 481

FCGR3B Protein Vector (Human) (pPM-C-His)
PV052080	ABM	500 ng	EUR 481

Recombinant Human FCGR3B Protein, His, Insect-10ug
QP11861-10ug	EnQuireBio	10ug	EUR 201

Recombinant Human FCGR3B Protein, His, Insect-1mg
QP11861-1mg	EnQuireBio	1mg	EUR 5251

Recombinant Human FCGR3B Protein, His, Insect-2ug
QP11861-2ug	EnQuireBio	2ug	EUR 155

FCGR3B 3'UTR Luciferase Stable Cell Line
TU007835	ABM	1.0 ml	EUR 1521

FCGR3B 3'UTR GFP Stable Cell Line
TU057835	ABM	1.0 ml	EUR 1521

Recombinant Human Fc γ RIIIB/FCGR3B/CD16b (C-6His)
CB62-10ug	Novoprotein	10ug	EUR 156
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Human Fc γ RIIIB/FCGR3B/CD16b (C-6His)
CB62-1mg	Novoprotein	1mg	EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Human Fc γ RIIIB/FCGR3B/CD16b (C-6His)
CB62-500ug	Novoprotein	500ug	EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Human Fc γ RIIIB/FCGR3B/CD16b (C-6His)
CB62-50ug	Novoprotein	50ug	EUR 369
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Fc Fragment of IgG Low Affinity IIIb Receptor (FCGR3B) Antibody
abx145933-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Fc Fragment Of IgG Low Affinity IIIb Receptor (FCGR3B) Antibody
20-abx104439	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Recombinant Human Fc γ RIIIB/FCGR3B/CD16b (C-Fc-6His)
CB85-10ug	Novoprotein	10ug	EUR 146
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

Recombinant Human Fc γ RIIIB/FCGR3B/CD16b (C-Fc-6His)
CB85-1mg	Novoprotein	1mg	EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

Recombinant Human Fc γ RIIIB/FCGR3B/CD16b (C-Fc-6His)
CB85-500ug	Novoprotein	500ug	EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

Recombinant Human Fc γ RIIIB/FCGR3B/CD16b (C-Fc-6His)
CB85-50ug	Novoprotein	50ug	EUR 303
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

Fc Fragment of IgG Low Affinity IIIb Receptor (FCGR3B) Antibody
20-abx006572	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Fc Fragment Of IgG Low Affinity IIIb Receptor (FCGR3B) Antibody
20-abx270096	Abbexa	EUR 467.00 EUR 537.00 EUR 272.00 EUR 815.00 EUR 356.00	100 tests 200 tests 25 tests 500 tests 50 tests
Shipped within 5-12 working days.

Fc Fragment Of IgG Low Affinity IIIb Receptor (FCGR3B) Antibody
20-abx172357	Abbexa	EUR 328.00 EUR 815.00 EUR 425.00 EUR 154.00 EUR 258.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-12 working days.

FCGR3B sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0769805	ABM	3 x 1.0 ug	EUR 376

Recombinant Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B)
4-RPB271Hu01	Cloud-Clone	EUR 422.56 EUR 216.00 EUR 1309.60 EUR 503.20 EUR 906.40 EUR 346.00 EUR 3124.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O75015 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 24.2kDa Isoelectric Point: 6.9
Description: Recombinant Human Fc Fragment Of IgG Low Affinity IIIb Receptor expressed in: E.coli

Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FCGR3B) Protein
20-abx066544	Abbexa	EUR 592.00 EUR 258.00 EUR 1776.00 EUR 704.00 EUR 439.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Fc Fragment Of IgG Low Affinity IIIb Receptor (FCGR3B) Antibody (FITC)
20-abx270394	Abbexa	EUR 523.00 EUR 606.00 EUR 300.00 EUR 940.00 EUR 384.00	100 tests 200 tests 25 tests 500 tests 50 tests
Shipped within 5-15 working days.

Fc Fragment Of IgG Low Affinity IIIb Receptor (FCGR3B) Antibody (APC)
20-abx270626	Abbexa	EUR 704.00 EUR 829.00 EUR 370.00 EUR 1330.00 EUR 495.00	100 tests 200 tests 25 tests 500 tests 50 tests
Shipped within 5-15 working days.

Fc Fragment Of IgG Low Affinity IIIb Receptor (FCGR3B) Antibody (PE)
20-abx270858	Abbexa	EUR 606.00 EUR 718.00 EUR 328.00 EUR 1135.00 EUR 439.00	100 tests 200 tests 25 tests 500 tests 50 tests
Shipped within 5-15 working days.

FCGR3B sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0769806	ABM	1.0 ug DNA	EUR 167

FCGR3B sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0769807	ABM	1.0 ug DNA	EUR 167

FCGR3B sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0769808	ABM	1.0 ug DNA	EUR 167

Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FCGR3B) ELISA Kit
20-abx151500	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Pig Fc Fragment Of IgG Low Affinity IIIb Receptor (FCGR3B) ELISA Kit
abx361180-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Fc Fragment Of IgG Low Affinity IIIb Receptor (FCGR3B) ELISA Kit
abx363020-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Sheep Fc Fragment Of IgG Low Affinity IIIb Receptor (FCGR3B) ELISA Kit
abx364106-96tests	Abbexa	96 tests	EUR 926
Shipped within 5-12 working days.

Chicken Fc Fragment Of IgG Low Affinity IIIb Receptor (FCGR3B) ELISA Kit
abx355878-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Monkey Fc Fragment Of IgG Low Affinity IIIb Receptor (FCGR3B) ELISA Kit
abx359430-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FCGR3B) CLIA Kit
20-abx492573	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FCGR3B) ELISA Kit
abx251907-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) Polyclonal Antibody (Human)
4-PAB271Hu01	Cloud-Clone	EUR 239.00 EUR 2391.00 EUR 598.00 EUR 299.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FcgR3B (Pro24~Ser203) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B)

Human Fc Fragment Of IgG Low Affinity IIIb Receptor(FcgR3B)ELISA Kit
QY-E04862	Qayee Biotechnology	96T	EUR 361

Human Fc Fragment Of IgG Low Affinity IIIb Receptor ELISA Kit (FcgR3B)
RK01371	Abclonal	96 Tests	EUR 521

Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit
SEB271Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4502.43
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit
SEB271Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 458.44
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit
SEB271Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 612.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit
SEB271Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2454.23
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit
4-SEB271Hu	Cloud-Clone	EUR 4553.00 EUR 2405.00 EUR 613.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Fc Fragment Of IgG Low Affinity IIIb Receptor elisa. Alternative names of the recognized antigen: CD16b CD16-B FCGR3-B FCG3 FcgRIII Low affinity immunoglobulin gamma Fc region receptor III-B
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Low affinity immunoglobulin gamma Fc region receptor III-B(FCGR3B) ELISA kit
CSB-EL008544HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Low affinity immunoglobulin gamma Fc region receptor III-B (FCGR3B) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Low affinity immunoglobulin gamma Fc region receptor III-B(FCGR3B) ELISA kit
1-CSB-EL008544HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Low affinity immunoglobulin gamma Fc region receptor III-B(FCGR3B) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Fc Fragment Of IgG Low Affinity IIIb Receptor (CD16b) (FCGR3B) ELISA Kit
abx573729-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Fc Fragment Of IgG, Low Affinity IIIb, Receptor (CD16b) (FCGR3B) ELISA Kit
abx252444-96tests	Abbexa	96 tests	EUR 637
Shipped within 5-12 working days.

ELISA kit for Human FcgR3B (Fc Fragment Of IgG Low Affinity IIIb Receptor)
ELK2798	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated Show more
Description: A sandwich ELISA kit for detection of Fc Fragment Of IgG Low Affinity IIIb Receptor from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Monkey Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit
E09L0113-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit
E09L0113-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit
E09L0113-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit
E08L0113-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit
E08L0113-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit
E08L0113-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit
E06L0113-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit
E06L0113-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit
E06L0113-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit
E04L0113-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit
E04L0113-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit
E04L0113-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human FCGR3B/ Low affinity immunoglobulin gamma Fc region receptor III-B ELISA Kit
E0880Hu	Sunlong	1 Kit	EUR 605

Pig Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit
E07L0113-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit
E07L0113-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit
E07L0113-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit
E02L0113-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit
E02L0113-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit
E02L0113-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit
E03L0113-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit
E03L0113-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit
E03L0113-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit
E01L0113-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit
E01L0113-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit
E01L0113-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) Polyclonal Antibody (Human), APC
4-PAB271Hu01-APC	Cloud-Clone	EUR 333.00 EUR 3113.00 EUR 872.00 EUR 423.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FcgR3B (Pro24~Ser203) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B). This antibody is labeled with APC.

Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) Polyclonal Antibody (Human), Biotinylated
4-PAB271Hu01-Biotin	Cloud-Clone	EUR 303.00 EUR 2341.00 EUR 697.00 EUR 369.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FcgR3B (Pro24~Ser203) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B). This antibody is labeled with Biotin.

Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) Polyclonal Antibody (Human), Cy3
4-PAB271Hu01-Cy3	Cloud-Clone	EUR 403.00 EUR 4109.00 EUR 1121.00 EUR 523.00 EUR 245.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FcgR3B (Pro24~Ser203) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B). This antibody is labeled with Cy3.

Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) Polyclonal Antibody (Human), FITC
4-PAB271Hu01-FITC	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FcgR3B (Pro24~Ser203) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B). This antibody is labeled with FITC.

Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) Polyclonal Antibody (Human), HRP
4-PAB271Hu01-HRP	Cloud-Clone	EUR 305.00 EUR 2714.00 EUR 772.00 EUR 383.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FcgR3B (Pro24~Ser203) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B). This antibody is labeled with HRP.

Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) Polyclonal Antibody (Human), PE
4-PAB271Hu01-PE	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FcgR3B (Pro24~Ser203) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B). This antibody is labeled with PE.

Rabbit Anti-Human FcGR3b/FCRIII/CD16b Protein (NA2 allotype, 1-200aa) IgG, aff pure
FCGR3B331-A	Alpha Diagnostics	100 ug	EUR 482

Guinea pig Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit
E05L0113-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit
E05L0113-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit
E05L0113-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) Polyclonal Antibody (Human), APC-Cy7
4-PAB271Hu01-APC-Cy7	Cloud-Clone	EUR 547.00 EUR 6106.00 EUR 1624.00 EUR 727.00 EUR 310.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FcgR3B (Pro24~Ser203) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B). This antibody is labeled with APC-Cy7.

Mouse Monoclonal Anti-Human FcGR3b/FCRIII/CD16b Protein (NA2 allotype, 1-200aa) IgG, aff pure
FCGR3B332-M	Alpha Diagnostics	100 ug	EUR 482

Recombinant (E. coli) Human FcGR3b/FCRIII/CD16b Protein (18-193aa, >95%, No-tag, ~22 kda), active
FCGR3B31-R-25	Alpha Diagnostics	25 ug	EUR 347

Recombinant (CHO) Human FcGR3b/FCRIII/CD16b Protein (1-200aa, >95%, His-tag, ~38-43 kda, low endotoxin), active
FCGR3B32-R-25	Alpha Diagnostics	25 ug	EUR 347

Recombinant (HEK) Human FcGR3b/FCRIII/CD16b Protein (NA2allotype, 1-200aa, >95%, His-tag, ~50-55 kda, low endotoxin), active
FCGR3B33-R-25	Alpha Diagnostics	25 ug	EUR 347

Additionally, it is concluded that hemalum inhibits PCR by interfering with DNA extraction, preventing DNA polymerase attachment and possibly by rescuing divalent cations. Accordingly, proper sample purification and adjustment of PCR conditions are of key importance to achieve satisfactory results by PCR in H&E- and Pap-stained samples.

Furthermore, although H&E results in RNA fragmentation, it is possible to perform expression analysis in H&E-stained frozen sections, using RNase-free conditions, low amounts of hematoxylin and a rapid protocol from sample collection to RNA analysis. It The effect of Pap-staining on RNA integrity remains to be determined.