Molecular pathology allows the identification of causative agents in infectious diseases and detection of biomarkers important for prediction of disease susceptibility, diagnosis and personalized therapy. Accordingly, nucleic acid-based methods have gained a special role in clinical laboratories particularly to evaluate solid and hematological tumors. Extraction of nucleic acids is commonly performed in microdissected formalin-fixed paraffin-embedded (FFPE) or cytological samples that had been previously evaluated through the use of hematoxylin and eosin (H&E) or Papanicolau (Pap) stains, respectively.
Although the effect of both stains on nucleic acids integrity has been explored by several authors, the results are not consistent and require further examination. Accordingly, the goal of this review was to assess the influence of H&E and Pap stains on DNA and RNA integrity and to address the mechanism by which each staining compromises molecular based-analysis. The analyzed studies demonstrate that H&E- and Pap-staining result in low DNA recovery and some degree of DNA fragmentation.
 ELISA Kit) Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit |
| DL-FcgR3B-Hu-48 |
DLdevelop |
1 kit of 48 tests |
EUR 465.00 |
|
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) |
Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit |
| DL-FcgR3B-Hu-96 |
DLdevelop |
1 kit of 96 tests |
EUR 621.00 |
|
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) |
Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit |
| DLR-FcgR3B-Hu-48T |
DL Develop |
48T |
EUR 498.00 |
- Should the Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit |
| DLR-FcgR3B-Hu-96T |
DL Develop |
96T |
EUR 647.00 |
- Should the Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit |
| RD-FcgR3B-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500.00 |
Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit |
| RD-FcgR3B-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692.00 |
Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit |
| RDR-FcgR3B-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 522.00 |
Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit |
| RDR-FcgR3B-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 724.00 |
 FCGR3B Antibody |
| 1-CSB-PA008544LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against FCGR3B. Recognizes FCGR3B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200 |
 FCGR3B siRNA |
| 20-abx916694 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 FCGR3A/FCGR3B Antibody |
| 1-CSB-PA676166 |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
|
|
Description: A polyclonal antibody against FCGR3A/FCGR3B. Recognizes FCGR3A/FCGR3B from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC-p:1:50-300, ELISA:1:10000-20000 |
 FCGR3B cloning plasmid |
| CSB-CL008544HU-10ug |
Cusabio |
10ug |
EUR 233.00 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 702
- Sequence: ATGTGGCAGCTGCTCCTCCCAACTGCTCTGCTACTTCTAGTTTCAGCTGGCATGCGGACTGAAGATCTCCCAAAGGCTGTGGTGTTCCTGGAGCCTCAATGGTACAGCGTGCTTGAGAAGGACAGTGTGACTCTGAAGTGCCAGGGAGCCTACTCCCCTGAGGACAATTCCACACA
- Show more
|
|
Description: A cloning plasmid for the FCGR3B gene. |
 FCGR3B Polyclonal Antibody |
| 28411-100ul |
SAB |
100ul |
EUR 252.00 |
FCGR3B Polyclonal Antibody |
| 28411-50ul |
SAB |
50ul |
EUR 187.00 |
FCGR3B Polyclonal Antibody |
| 31372-100ul |
SAB |
100ul |
EUR 252.00 |
FCGR3B Polyclonal Antibody |
| 31372-50ul |
SAB |
50ul |
EUR 187.00 |
 FCGR3A / FCGR3B Antibody |
| 20-abx323190 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 FCGR3B Rabbit pAb |
| A13980-100ul |
Abclonal |
100 ul |
EUR 308.00 |
FCGR3B Rabbit pAb |
| A13980-200ul |
Abclonal |
200 ul |
EUR 459.00 |
FCGR3B Rabbit pAb |
| A13980-20ul |
Abclonal |
20 ul |
EUR 183.00 |
FCGR3B Rabbit pAb |
| A13980-50ul |
Abclonal |
50 ul |
EUR 223.00 |
FCGR3B Rabbit pAb |
| A7894-100ul |
Abclonal |
100 ul |
EUR 308.00 |
FCGR3B Rabbit pAb |
| A7894-200ul |
Abclonal |
200 ul |
EUR 459.00 |
FCGR3B Rabbit pAb |
| A7894-20ul |
Abclonal |
20 ul |
EUR 183.00 |
FCGR3B Rabbit pAb |
| A7894-50ul |
Abclonal |
50 ul |
EUR 223.00 |
 Anti-FCGR3B antibody |
| STJ110203 |
St John's Laboratory |
100 µl |
EUR 277.00 |
|
Description: The protein encoded by this gene is a low affinity receptor for the Fc region of gamma immunoglobulins (IgG). The encoded protein acts as a monomer and can bind either monomeric or aggregated IgG. This gene may function to capture immune complexes in the peripheral circulation. Several transcript variants encoding different isoforms have been found for this gene. A highly-similar gene encoding a related protein is also found on chromosome 1. |
Anti-FCGR3B antibody |
| STJ115915 |
St John's Laboratory |
100 µl |
EUR 277.00 |
|
Description: The protein encoded by this gene is a low affinity receptor for the Fc region of gamma immunoglobulins (IgG). The encoded protein acts as a monomer and can bind either monomeric or aggregated IgG. This gene may function to capture immune complexes in the peripheral circulation. Several transcript variants encoding different isoforms have been found for this gene. A highly-similar gene encoding a related protein is also found on chromosome 1. |
 FCGR3B Antibody, HRP conjugated |
| 1-CSB-PA008544LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against FCGR3B. Recognizes FCGR3B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 FCGR3B Antibody, FITC conjugated |
| 1-CSB-PA008544LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against FCGR3B. Recognizes FCGR3B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 FCGR3B Antibody, Biotin conjugated |
| 1-CSB-PA008544LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against FCGR3B. Recognizes FCGR3B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 Human FCGR3B shRNA Plasmid |
| 20-abx951549 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 FCGR3B Polyclonal Conjugated Antibody |
| C28411 |
SAB |
100ul |
EUR 397.00 |
FCGR3B Polyclonal Conjugated Antibody |
| C31372 |
SAB |
100ul |
EUR 397.00 |
) FCGR3B Recombinant Protein (Human) |
| RP039058 |
ABM |
100 ug |
Ask for price |
 Monkey FCGR3b ELISA Kit |
| EMKF0073 |
Abclonal |
96Tests |
EUR 521.00 |
 Anserini FCGR3b ELISA Kit |
| EAF0073 |
Abclonal |
96Tests |
EUR 521.00 |
 Bovine FCGR3b ELISA Kit |
| EBF0073 |
Abclonal |
96Tests |
EUR 521.00 |
 Human FCGR3b ELISA Kit |
| EHF0073 |
Abclonal |
96Tests |
EUR 521.00 |
 Goat FCGR3b ELISA Kit |
| EGTF0073 |
Abclonal |
96Tests |
EUR 521.00 |
 Chicken FCGR3b ELISA Kit |
| ECKF0073 |
Abclonal |
96Tests |
EUR 521.00 |
 Canine FCGR3b ELISA Kit |
| ECF0073 |
Abclonal |
96Tests |
EUR 521.00 |
 Sheep FCGR3b ELISA Kit |
| ESF0073 |
Abclonal |
96Tests |
EUR 521.00 |
 Porcine FCGR3b ELISA Kit |
| EPF0073 |
Abclonal |
96Tests |
EUR 521.00 |
 Rat FCGR3b ELISA Kit |
| ERF0073 |
Abclonal |
96Tests |
EUR 521.00 |
 Mouse FCGR3b ELISA Kit |
| EMF0073 |
Abclonal |
96Tests |
EUR 521.00 |
 Rabbit FCGR3b ELISA Kit |
| ERTF0073 |
Abclonal |
96Tests |
EUR 521.00 |
 (pORF)) FCGR3B ORF Vector (Human) (pORF) |
| ORF013020 |
ABM |
1.0 ug DNA |
EUR 354.00 |
 FCGR3B CD16b Human Recombinant Protein |
| PROTO75015 |
BosterBio |
Regular: 10ug |
EUR 317.00 |
|
Description: FCGR3B produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 188 amino acids (21-200a.a.) and having a molecular mass of 21.4kDa. (Molecular size on SDS-PAGE will appear at approximately 28-40kDa).;FCGR3B is expressed with an 8 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques. |
 Guinea Pig FCGR3b ELISA Kit |
| EGF0073 |
Abclonal |
96Tests |
EUR 521.00 |
) Polyclonal FCGR3B Antibody (N-term) |
| APR04631G |
Leading Biology |
0.1ml |
EUR 484.00 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FCGR3B (N-term). This antibody is tested and proven to work in the following applications: |
) FCGR3B sgRNA CRISPR Lentivector set (Human) |
| K0769801 |
ABM |
3 x 1.0 ug |
EUR 339.00 |
 (Target 1)) FCGR3B sgRNA CRISPR Lentivector (Human) (Target 1) |
| K0769802 |
ABM |
1.0 ug DNA |
EUR 154.00 |
 (Target 2)) FCGR3B sgRNA CRISPR Lentivector (Human) (Target 2) |
| K0769803 |
ABM |
1.0 ug DNA |
EUR 154.00 |
 (Target 3)) FCGR3B sgRNA CRISPR Lentivector (Human) (Target 3) |
| K0769804 |
ABM |
1.0 ug DNA |
EUR 154.00 |
 (pPB-C-His)) FCGR3B Protein Vector (Human) (pPB-C-His) |
| PV052077 |
ABM |
500 ng |
EUR 481.00 |
 (pPB-N-His)) FCGR3B Protein Vector (Human) (pPB-N-His) |
| PV052078 |
ABM |
500 ng |
EUR 481.00 |
 (pPM-C-HA)) FCGR3B Protein Vector (Human) (pPM-C-HA) |
| PV052079 |
ABM |
500 ng |
EUR 481.00 |
 (pPM-C-His)) FCGR3B Protein Vector (Human) (pPM-C-His) |
| PV052080 |
ABM |
500 ng |
EUR 481.00 |
 FCGR3B 3'UTR Luciferase Stable Cell Line |
| TU007835 |
ABM |
1.0 ml |
EUR 1521.00 |
 FCGR3B 3'UTR GFP Stable Cell Line |
| TU057835 |
ABM |
1.0 ml |
EUR 1521.00 |
 Recombinant Human FCGR3B Protein, His, Insect-10ug |
| QP11861-10ug |
EnQuireBio |
10ug |
EUR 201.00 |
 Recombinant Human FCGR3B Protein, His, Insect-1mg |
| QP11861-1mg |
EnQuireBio |
1mg |
EUR 5251.00 |
 Recombinant Human FCGR3B Protein, His, Insect-2ug |
| QP11861-2ug |
EnQuireBio |
2ug |
EUR 155.00 |
) Recombinant Human Fc γ RIIIB/FCGR3B/CD16b (C-6His) |
| CB62-10ug |
Novoprotein |
10ug |
EUR 156.00 |
|
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4. |
Recombinant Human Fc γ RIIIB/FCGR3B/CD16b (C-6His) |
| CB62-1mg |
Novoprotein |
1mg |
EUR 2283.00 |
|
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4. |
Recombinant Human Fc γ RIIIB/FCGR3B/CD16b (C-6His) |
| CB62-500ug |
Novoprotein |
500ug |
EUR 1613.00 |
|
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4. |
Recombinant Human Fc γ RIIIB/FCGR3B/CD16b (C-6His) |
| CB62-50ug |
Novoprotein |
50ug |
EUR 369.00 |
|
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4. |
 Antibody) Fc Fragment of IgG Low Affinity IIIb Receptor (FCGR3B) Antibody |
| 20-abx006572 |
Abbexa |
- EUR 411.00
- EUR 592.00
- EUR 182.00
- EUR 314.00
|
- 100 ul
- 200 ul
- 20 ul
- 50 ul
|
- Shipped within 5-10 working days.
|
 Antibody) Fc Fragment Of IgG Low Affinity IIIb Receptor (FCGR3B) Antibody |
| 20-abx104439 |
Abbexa |
- EUR 411.00
- EUR 133.00
- EUR 1149.00
- EUR 565.00
- EUR 314.00
|
- 100 ug
- 10 ug
- 1 mg
- 200 ug
- 50 ug
|
- Shipped within 5-7 working days.
|
) FCGR3B sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human) |
| K0769805 |
ABM |
3 x 1.0 ug |
EUR 376.00 |
Fc Fragment Of IgG Low Affinity IIIb Receptor (FCGR3B) Antibody |
| 20-abx270096 |
Abbexa |
- EUR 467.00
- EUR 537.00
- EUR 272.00
- EUR 815.00
- EUR 356.00
|
- 100 tests
- 200 tests
- 25 tests
- 500 tests
- 50 tests
|
- Shipped within 5-12 working days.
|
Fc Fragment of IgG Low Affinity IIIb Receptor (FCGR3B) Antibody |
| abx145933-100ug |
Abbexa |
100 ug |
EUR 391.00 |
- Shipped within 5-10 working days.
|
Fc Fragment Of IgG Low Affinity IIIb Receptor (FCGR3B) Antibody |
| 20-abx172357 |
Abbexa |
- EUR 328.00
- EUR 815.00
- EUR 425.00
- EUR 154.00
- EUR 258.00
|
- 100 ug
- 1 mg
- 200 ug
- 20 ug
- 50 ug
|
- Shipped within 5-12 working days.
|
) Recombinant Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) |
| 4-RPB271Hu01 |
Cloud-Clone |
- EUR 422.56
- EUR 216.00
- EUR 1309.60
- EUR 503.20
- EUR 906.40
- EUR 346.00
- EUR 3124.00
|
- 100 ug
- 10ug
- 1 mg
- 200 ug
- 500 ug
- 50ug
- 5 mg
|
- Uniprot ID: O75015
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 24.2kDa
- Isoelectric Point: 6.9
|
|
Description: Recombinant Human Fc Fragment Of IgG Low Affinity IIIb Receptor expressed in: E.coli |
) Recombinant Human Fc γ RIIIB/FCGR3B/CD16b (C-Fc-6His) |
| CB85-10ug |
Novoprotein |
10ug |
EUR 146.00 |
|
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4. |
Recombinant Human Fc γ RIIIB/FCGR3B/CD16b (C-Fc-6His) |
| CB85-1mg |
Novoprotein |
1mg |
EUR 2283.00 |
|
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4. |
Recombinant Human Fc γ RIIIB/FCGR3B/CD16b (C-Fc-6His) |
| CB85-500ug |
Novoprotein |
500ug |
EUR 1613.00 |
|
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4. |
Recombinant Human Fc γ RIIIB/FCGR3B/CD16b (C-Fc-6His) |
| CB85-50ug |
Novoprotein |
50ug |
EUR 303.00 |
|
Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4. |
 (Target 1)) FCGR3B sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1) |
| K0769806 |
ABM |
1.0 ug DNA |
EUR 167.00 |
 (Target 2)) FCGR3B sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2) |
| K0769807 |
ABM |
1.0 ug DNA |
EUR 167.00 |
 (Target 3)) FCGR3B sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3) |
| K0769808 |
ABM |
1.0 ug DNA |
EUR 167.00 |
 Antibody (PE)) Fc Fragment Of IgG Low Affinity IIIb Receptor (FCGR3B) Antibody (PE) |
| 20-abx270858 |
Abbexa |
- EUR 606.00
- EUR 718.00
- EUR 328.00
- EUR 1135.00
- EUR 439.00
|
- 100 tests
- 200 tests
- 25 tests
- 500 tests
- 50 tests
|
- Shipped within 5-15 working days.
|
 Antibody (FITC)) Fc Fragment Of IgG Low Affinity IIIb Receptor (FCGR3B) Antibody (FITC) |
| 20-abx270394 |
Abbexa |
- EUR 523.00
- EUR 606.00
- EUR 300.00
- EUR 940.00
- EUR 384.00
|
- 100 tests
- 200 tests
- 25 tests
- 500 tests
- 50 tests
|
- Shipped within 5-15 working days.
|
 Antibody (APC)) Fc Fragment Of IgG Low Affinity IIIb Receptor (FCGR3B) Antibody (APC) |
| 20-abx270626 |
Abbexa |
- EUR 704.00
- EUR 829.00
- EUR 370.00
- EUR 1330.00
- EUR 495.00
|
- 100 tests
- 200 tests
- 25 tests
- 500 tests
- 50 tests
|
- Shipped within 5-15 working days.
|
 Protein) Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FCGR3B) Protein |
| 20-abx066544 |
Abbexa |
- EUR 592.00
- EUR 258.00
- EUR 1776.00
- EUR 704.00
- EUR 439.00
|
- 100 ug
- 10 ug
- 1 mg
- 200 ug
- 50 ug
|
- Shipped within 5-7 working days.
|
 ELISA Kit) Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FCGR3B) ELISA Kit |
| 20-abx151500 |
Abbexa |
- EUR 7112.00
- EUR 3792.00
- EUR 879.00
|
- 10 × 96 tests
- 5 × 96 tests
- 96 tests
|
- Shipped within 5-7 working days.
|
 ELISA Kit) Pig Fc Fragment Of IgG Low Affinity IIIb Receptor (FCGR3B) ELISA Kit |
| abx361180-96tests |
Abbexa |
96 tests |
EUR 825.00 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Sheep Fc Fragment Of IgG Low Affinity IIIb Receptor (FCGR3B) ELISA Kit |
| abx364106-96tests |
Abbexa |
96 tests |
EUR 926.00 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Rabbit Fc Fragment Of IgG Low Affinity IIIb Receptor (FCGR3B) ELISA Kit |
| abx363020-96tests |
Abbexa |
96 tests |
EUR 825.00 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Monkey Fc Fragment Of IgG Low Affinity IIIb Receptor (FCGR3B) ELISA Kit |
| abx359430-96tests |
Abbexa |
96 tests |
EUR 825.00 |
- Shipped within 5-12 working days.
|
 CLIA Kit) Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FCGR3B) CLIA Kit |
| 20-abx492573 |
Abbexa |
- EUR 7973.00
- EUR 4246.00
- EUR 981.00
|
- 10 × 96 tests
- 5 × 96 tests
- 96 tests
|
|
|
Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FCGR3B) ELISA Kit |
| abx251907-96tests |
Abbexa |
96 tests |
EUR 754.00 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Chicken Fc Fragment Of IgG Low Affinity IIIb Receptor (FCGR3B) ELISA Kit |
| abx355878-96tests |
Abbexa |
96 tests |
EUR 825.00 |
- Shipped within 5-12 working days.
|
Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit |
| SEB271Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4502.43 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit |
| SEB271Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 458.44 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit |
| SEB271Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 612.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit |
| SEB271Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2454.23 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit |
| 4-SEB271Hu |
Cloud-Clone |
- EUR 4553.00
- EUR 2405.00
- EUR 613.00
|
- 10 plates of 96 wells
- 5 plates of 96 wells
- 1 plate of 96 wells
|
- Known also as Fc Fragment Of IgG Low Affinity IIIb Receptor elisa. Alternative names of the recognized antigen: CD16b
- CD16-B
- FCGR3-B
- FCG3
- FcgRIII
- Low affinity immunoglobulin gamma Fc region receptor III-B
|
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
 Polyclonal Antibody (Human)) Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) Polyclonal Antibody (Human) |
| 4-PAB271Hu01 |
Cloud-Clone |
- EUR 239.00
- EUR 2391.00
- EUR 598.00
- EUR 299.00
- EUR 211.00
|
- 100ul
- 10ml
- 1ml
- 200ul
- 20ul
|
- Sequence of the immunogen: FcgR3B (Pro24~Ser203)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) |
) Human Fc Fragment Of IgG Low Affinity IIIb Receptor ELISA Kit (FcgR3B) |
| RK01371 |
Abclonal |
96 Tests |
EUR 521.00 |
ELISA Kit) Human Fc Fragment Of IgG Low Affinity IIIb Receptor(FcgR3B)ELISA Kit |
| QY-E04862 |
Qayee Biotechnology |
96T |
EUR 361.00 |
 ELISA kit) Pig Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit |
| E07L0113-192T |
B-Gene |
192 tests |
EUR 1270.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Porcine Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit |
| E07L0113-48 |
B-Gene |
1 plate of 48 wells |
EUR 520.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Porcine Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit |
| E07L0113-96 |
B-Gene |
1 plate of 96 wells |
EUR 685.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Porcine Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Dog Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit |
| E08L0113-192T |
B-Gene |
192 tests |
EUR 1270.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Canine Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit |
| E08L0113-48 |
B-Gene |
1 plate of 48 wells |
EUR 520.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Canine Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit |
| E08L0113-96 |
B-Gene |
1 plate of 96 wells |
EUR 685.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Canine Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 (FCGR3B) ELISA Kit) Human Fc Fragment Of IgG Low Affinity IIIb Receptor (CD16b) (FCGR3B) ELISA Kit |
| abx573729-96tests |
Abbexa |
96 tests |
EUR 668.00 |
- Shipped within 5-12 working days.
|
 (FCGR3B) ELISA Kit) Human Fc Fragment Of IgG, Low Affinity IIIb, Receptor (CD16b) (FCGR3B) ELISA Kit |
| abx252444-96tests |
Abbexa |
96 tests |
EUR 637.00 |
- Shipped within 5-12 working days.
|
 ELISA kit) Human Low affinity immunoglobulin gamma Fc region receptor III-B(FCGR3B) ELISA kit |
| CSB-EL008544HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165.00 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Human Low affinity immunoglobulin gamma Fc region receptor III-B (FCGR3B) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Low affinity immunoglobulin gamma Fc region receptor III-B(FCGR3B) ELISA kit |
| 1-CSB-EL008544HU |
Cusabio |
- EUR 804.00
- EUR 5099.00
- EUR 2704.00
|
- 1 plate of 96 wells
- 10 plates of 96 wells each
- 5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Human Low affinity immunoglobulin gamma Fc region receptor III-B(FCGR3B) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
 ELISA kit) Rabbit Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit |
| E04L0113-192T |
B-Gene |
192 tests |
EUR 1270.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit |
| E04L0113-48 |
B-Gene |
1 plate of 48 wells |
EUR 520.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit |
| E04L0113-96 |
B-Gene |
1 plate of 96 wells |
EUR 685.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Goat Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit |
| E06L0113-192T |
B-Gene |
192 tests |
EUR 1270.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Goat Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit |
| E06L0113-48 |
B-Gene |
1 plate of 48 wells |
EUR 520.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Goat Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit |
| E06L0113-96 |
B-Gene |
1 plate of 96 wells |
EUR 685.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Goat Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Human Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit |
| E01L0113-192T |
B-Gene |
192 tests |
EUR 1270.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit |
| E01L0113-48 |
B-Gene |
1 plate of 48 wells |
EUR 520.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit |
| E01L0113-96 |
B-Gene |
1 plate of 96 wells |
EUR 685.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Rat Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit |
| E02L0113-192T |
B-Gene |
192 tests |
EUR 1270.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rat Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit |
| E02L0113-48 |
B-Gene |
1 plate of 48 wells |
EUR 520.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rat Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit |
| E02L0113-96 |
B-Gene |
1 plate of 96 wells |
EUR 685.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rat Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Mouse Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit |
| E03L0113-192T |
B-Gene |
192 tests |
EUR 1270.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Mouse Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit |
| E03L0113-48 |
B-Gene |
1 plate of 48 wells |
EUR 520.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Mouse Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit |
| E03L0113-96 |
B-Gene |
1 plate of 96 wells |
EUR 685.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Mouse Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit) Monkey Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit |
| E09L0113-192T |
B-Gene |
192 tests |
EUR 1270.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Monkey Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit |
| E09L0113-48 |
B-Gene |
1 plate of 48 wells |
EUR 520.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Monkey Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit |
| E09L0113-96 |
B-Gene |
1 plate of 96 wells |
EUR 685.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Monkey Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
) ELISA kit for Human FcgR3B (Fc Fragment Of IgG Low Affinity IIIb Receptor) |
| ELK2798 |
ELK Biotech |
1 plate of 96 wells |
EUR 432.00 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated
- Show more
|
|
Description: A sandwich ELISA kit for detection of Fc Fragment Of IgG Low Affinity IIIb Receptor from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
 Polyclonal Antibody (Human), APC) Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) Polyclonal Antibody (Human), APC |
| 4-PAB271Hu01-APC |
Cloud-Clone |
- EUR 333.00
- EUR 3113.00
- EUR 872.00
- EUR 423.00
- EUR 215.00
|
- 100ul
- 10ml
- 1ml
- 200ul
- 20ul
|
- Sequence of the immunogen: FcgR3B (Pro24~Ser203)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B). This antibody is labeled with APC. |
 Polyclonal Antibody (Human), Biotinylated) Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) Polyclonal Antibody (Human), Biotinylated |
| 4-PAB271Hu01-Biotin |
Cloud-Clone |
- EUR 303.00
- EUR 2341.00
- EUR 697.00
- EUR 369.00
- EUR 216.00
|
- 100ul
- 10ml
- 1ml
- 200ul
- 20ul
|
- Sequence of the immunogen: FcgR3B (Pro24~Ser203)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Human), Cy3) Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) Polyclonal Antibody (Human), Cy3 |
| 4-PAB271Hu01-Cy3 |
Cloud-Clone |
- EUR 403.00
- EUR 4109.00
- EUR 1121.00
- EUR 523.00
- EUR 245.00
|
- 100ul
- 10ml
- 1ml
- 200ul
- 20ul
|
- Sequence of the immunogen: FcgR3B (Pro24~Ser203)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Human), FITC) Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) Polyclonal Antibody (Human), FITC |
| 4-PAB271Hu01-FITC |
Cloud-Clone |
- EUR 287.00
- EUR 2510.00
- EUR 717.00
- EUR 359.00
- EUR 192.00
|
- 100ul
- 10ml
- 1ml
- 200ul
- 20ul
|
- Sequence of the immunogen: FcgR3B (Pro24~Ser203)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B). This antibody is labeled with FITC. |
 Polyclonal Antibody (Human), HRP) Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) Polyclonal Antibody (Human), HRP |
| 4-PAB271Hu01-HRP |
Cloud-Clone |
- EUR 305.00
- EUR 2714.00
- EUR 772.00
- EUR 383.00
- EUR 203.00
|
- 100ul
- 10ml
- 1ml
- 200ul
- 20ul
|
- Sequence of the immunogen: FcgR3B (Pro24~Ser203)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B). This antibody is labeled with HRP. |
 Polyclonal Antibody (Human), PE) Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) Polyclonal Antibody (Human), PE |
| 4-PAB271Hu01-PE |
Cloud-Clone |
- EUR 287.00
- EUR 2510.00
- EUR 717.00
- EUR 359.00
- EUR 192.00
|
- 100ul
- 10ml
- 1ml
- 200ul
- 20ul
|
- Sequence of the immunogen: FcgR3B (Pro24~Ser203)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B). This antibody is labeled with PE. |
 Human FCGR3B/ Low affinity immunoglobulin gamma Fc region receptor III-B ELISA Kit |
| E0880Hu |
Sunlong |
1 Kit |
EUR 605.00 |
 ELISA kit) Guinea pig Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit |
| E05L0113-192T |
B-Gene |
192 tests |
EUR 1270.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit |
| E05L0113-48 |
B-Gene |
1 plate of 48 wells |
EUR 520.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) ELISA kit |
| E05L0113-96 |
B-Gene |
1 plate of 96 wells |
EUR 685.00 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Low affinity immunoglobulin gamma Fc region receptor III B(FCGR3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 IgG, aff pure) Rabbit Anti-Human FcGR3b/FCRIII/CD16b Protein (NA2 allotype, 1-200aa) IgG, aff pure |
| FCGR3B331-A |
Alpha Diagnostics |
100 ug |
EUR 482.00 |
 Polyclonal Antibody (Human), APC-Cy7) Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) Polyclonal Antibody (Human), APC-Cy7 |
| 4-PAB271Hu01-APC-Cy7 |
Cloud-Clone |
- EUR 547.00
- EUR 6106.00
- EUR 1624.00
- EUR 727.00
- EUR 310.00
|
- 100ul
- 10ml
- 1ml
- 200ul
- 20ul
|
- Sequence of the immunogen: FcgR3B (Pro24~Ser203)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B). This antibody is labeled with APC-Cy7. |
 IgG, aff pure) Mouse Monoclonal Anti-Human FcGR3b/FCRIII/CD16b Protein (NA2 allotype, 1-200aa) IgG, aff pure |
| FCGR3B332-M |
Alpha Diagnostics |
100 ug |
EUR 482.00 |
 Human FcGR3b/FCRIII/CD16b Protein (18-193aa, >95%, No-tag, ~22 kda), active) Recombinant (E. coli) Human FcGR3b/FCRIII/CD16b Protein (18-193aa, >95%, No-tag, ~22 kda), active |
| FCGR3B31-R-25 |
Alpha Diagnostics |
25 ug |
EUR 347.00 |
 Human FcGR3b/FCRIII/CD16b Protein (1-200aa, >95%, His-tag, ~38-43 kda, low endotoxin), active) Recombinant (CHO) Human FcGR3b/FCRIII/CD16b Protein (1-200aa, >95%, His-tag, ~38-43 kda, low endotoxin), active |
| FCGR3B32-R-25 |
Alpha Diagnostics |
25 ug |
EUR 347.00 |
 Human FcGR3b/FCRIII/CD16b Protein (NA2allotype, 1-200aa, >95%, His-tag, ~50-55 kda, low endotoxin), active) Recombinant (HEK) Human FcGR3b/FCRIII/CD16b Protein (NA2allotype, 1-200aa, >95%, His-tag, ~50-55 kda, low endotoxin), active |
| FCGR3B33-R-25 |
Alpha Diagnostics |
25 ug |
EUR 347.00 |
Additionally, it is concluded that hemalum inhibits PCR by interfering with DNA extraction, preventing DNA polymerase attachment and possibly by rescuing divalent cations. Accordingly, proper sample purification and adjustment of PCR conditions are of key importance to achieve satisfactory results by PCR in H&E- and Pap-stained samples.
Furthermore, although H&E results in RNA fragmentation, it is possible to perform expression analysis in H&E-stained frozen sections, using RNase-free conditions, low amounts of hematoxylin and a rapid protocol from sample collection to RNA analysis. It The effect of Pap-staining on RNA integrity remains to be determined.
